Sequence (5’ to 3’) | ϵ260nm (M−1cm−1) | DOI |
---|---|---|
TAGGGACGGGCGGGCAGGGT | 198600 | 10.1093/nar/gky250 |
Structure diagram of 5NYS
Circular dichroism spectra of the 5NYS oligonucleotide (10 µM), acquired at 25°C in 0.4-cm path-length cuvettes
1H-NMR spectrum of the 5NYS oligonucleotide, acquired at 25°C in 100 mM TMAA (pH 7.0) + 1 mM KCl
Folded fraction of the 5NYS oligonucleotide as a function of temperature, determined by UV-melting (λ = 295 nm)
Native ESI-MS spectra of the 5NYS oligonucleotide (10 µM)
Native ESI-MS spectra of the 5NYS oligonucleotide (10 µM), focused on the 5− charge state